View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2606_low_14 (Length: 309)
Name: NF2606_low_14
Description: NF2606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2606_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 9 - 309
Target Start/End: Complemental strand, 48645166 - 48644866
Alignment:
| Q |
9 |
agatgaaaactgtccaatagttttaatcaaacaagacattatatatatgtatagcaactgctagtaagtatacaagtaagcctttactaaaatgacatga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48645166 |
agatgaaaactgtccaatagttttaatcaaacaagacattatatatatgtatagcaactgctagtaagtatacaagtaagcctttactaaaatgacatga |
48645067 |
T |
 |
| Q |
109 |
ctctaacgaaggggagtggggtgnnnnnnnnnnnnnnnnnnntatatgtgaaatgtcaaatattgtaatgtcagtggtgtggtttgatctatataatatt |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48645066 |
ctctaacgaaggggagtggggtgaaaacaaaaaataaaaaaatatatgtgaaatgtcaaatattgtaatgtcagtggtgtggtttgatctatataatatt |
48644967 |
T |
 |
| Q |
209 |
tttgattcttctcttgctggctcgaccctacctctaatgggttactgctgttgccaccgtggcagaaccaatatttgcaggcacaactaaaccaccacca |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48644966 |
tttgattcttctcttgctggctcgaccctacctctaatgggttactgctgttgccaccgtggcagaaccaatatttgcaggcacaactaaaccaccacca |
48644867 |
T |
 |
| Q |
309 |
c |
309 |
Q |
| |
|
| |
|
|
| T |
48644866 |
c |
48644866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University