View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2606_low_19 (Length: 252)
Name: NF2606_low_19
Description: NF2606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2606_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 33966496 - 33966713
Alignment:
| Q |
17 |
aatatgtcttccatcgaagcttatctactactcaagtccaatcaattgattaccttaacatacatattttatcacaatttttcgcaatatcaagaattcc |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33966496 |
aatatgtcttccatccaagcttatctactactcgagtccaatcaattgattaccttaacatacatattttatcacaatttttcgcaatatcaagaattcc |
33966595 |
T |
|
| Q |
117 |
gacgtgaccgcaaattaaaaactttggacacaatcacaccacaaacaaaggaaaatgagataaagtatagtactactcacgtgtaaactcctgcatgaac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33966596 |
gacgtgaccgcaaattaaaaactttggacacaatgacaccacaaacaaaggaaaatgagataaagtatagtactactcacgtgtaaactcctgcatgaac |
33966695 |
T |
|
| Q |
217 |
cttgatgacaactctaac |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33966696 |
cttgatgacaactctaac |
33966713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 190 - 231
Target Start/End: Complemental strand, 43076909 - 43076868
Alignment:
| Q |
190 |
tactcacgtgtaaactcctgcatgaaccttgatgacaactct |
231 |
Q |
| |
|
|||| |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
43076909 |
tacttacgtgtaaacccctgcatgaaccttaatgacaactct |
43076868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University