View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2606_low_21 (Length: 239)
Name: NF2606_low_21
Description: NF2606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2606_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 26308966 - 26308769
Alignment:
| Q |
1 |
aaggagtttagttgaattatctgaacaaagtttgcttggaaaaaataaattggagaaattagaattcactgataattgcatacgaggaaaatcttataag |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| | |
|
|
| T |
26308966 |
aaggagtttagttgaattatctcaacaaagtttgcttggaaaaaataaattggagaaattagaattcacggataattgcatacgaggaaaatcatatagg |
26308867 |
T |
|
| Q |
101 |
gttaagtttaggagtgataagcatcatcctagtaattcctttaagtatgttcacttgtattttgggtccttctaaaatgaccactcgtgaagaggctc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
26308866 |
gttaagtttaggagtgataagcatcatcctagtaattcctttaagtatgttcacttgtattttgggtccttctaaagtgactactcgtggggaggctc |
26308769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University