View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2606_low_23 (Length: 212)
Name: NF2606_low_23
Description: NF2606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2606_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 32372608 - 32372407
Alignment:
| Q |
1 |
cttaccttcagctgaggaaccgtcgccttaagagacccctaattaggcaacattccgctaagaggaataaggggaatgatggaagccctaaatccccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32372608 |
cttaccttcagctgaggaaccgtcgccttaagagacccctaattaggcaacattccgctaagaggaataaggggaatgatggaagccctaaatccccaat |
32372509 |
T |
|
| Q |
101 |
tggggattcaactgctgaagagaaaactgttcagaagagtcctgagcctgaaaatgctgaatttggggagaatgctgaggaggatgctgagaggtgggta |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
32372508 |
tgggaattcaactgctgaagagaaaactgttcagaagagtcctgagcctgaaaatgctgaatttggggtgaatgctg---aggatgctgagaggtgggta |
32372412 |
T |
|
| Q |
201 |
tttcg |
205 |
Q |
| |
|
||||| |
|
|
| T |
32372411 |
tttcg |
32372407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University