View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2608_high_23 (Length: 213)
Name: NF2608_high_23
Description: NF2608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2608_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 31994110 - 31994287
Alignment:
| Q |
16 |
gagatgaagtaaaggagcagttcaagttgagagggaattcaagagatctaaagctgaagaagatattcaaaacttgagaaatttttcaaggtatgactac |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
31994110 |
gagaagaagtaaaggagcagttcaagttgagagggaattcaagagatctaaagctgaagaagatattcaaaccttgagaaatttttcaaggtatgagtac |
31994209 |
T |
|
| Q |
116 |
ttgaaaagaagggaggaaaagaaattgcaacagcttaaggagtatattctagatgaacaatatctatttgaaggagtt |
193 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31994210 |
ttgaaaagaagggaggaaaagaaactgcaacaccttaaggagtatattatagatgaacaatatctatttgaaggagtt |
31994287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University