View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2608_low_15 (Length: 250)
Name: NF2608_low_15
Description: NF2608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2608_low_15 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
| [»] scaffold0252 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 108 - 250
Target Start/End: Original strand, 43440400 - 43440541
Alignment:
| Q |
108 |
catatttaacccttttgaaaataatagcattacatataataaaattatttaaattttgtccactagacaaaaacccttcgttcaaccttaaacccttcaa |
207 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43440400 |
catatttaagccttttgaaaatagtagcattacatataataaaattatttaaattttgaccactagacaaaa-cccttcgttcaaccttaaacccttcaa |
43440498 |
T |
 |
| Q |
208 |
aaaacaacgtttgtgtcgcgcataggaacaacaaatccctcca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43440499 |
aaaacaacgtttgtgtcgcgcataggaacaacaaatccctcca |
43440541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 43434580 - 43434616
Alignment:
| Q |
177 |
aaaacccttcgttcaaccttaaacccttcaaaaaaca |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43434580 |
aaaacccatcgttcaaccttaaacccttcaaaaaaca |
43434616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0252 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 209
Target Start/End: Original strand, 20105 - 20137
Alignment:
| Q |
177 |
aaaacccttcgttcaaccttaaacccttcaaaa |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
20105 |
aaaacccatcgttcaaccttaaacccttcaaaa |
20137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University