View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2608_low_18 (Length: 237)
Name: NF2608_low_18
Description: NF2608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2608_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 33994658 - 33994779
Alignment:
| Q |
99 |
aaggcagtcaaaactcagaattagc-ataatatacattgcccattttaatatcattttatttactactccagtttaggtaaagtttttacatgagctgaa |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
33994658 |
aaggcagtcaaaactcagaattaggtataatatacattgcccattttaatatcattttatttactactccagttttggtaaagcttttaaatgagctgaa |
33994757 |
T |
 |
| Q |
198 |
ttttaccaatttgtggctctat |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33994758 |
ttttaccaatttgtggctctat |
33994779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 37 - 79
Target Start/End: Original strand, 10592836 - 10592878
Alignment:
| Q |
37 |
tcaattaaacaacattacccctgcatcagcttccacgttctaa |
79 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10592836 |
tcaattcaacaacattacccctgcatcagcttccacattctaa |
10592878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University