View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2608_low_20 (Length: 227)
Name: NF2608_low_20
Description: NF2608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2608_low_20 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 100 - 227
Target Start/End: Original strand, 26844753 - 26844880
Alignment:
| Q |
100 |
aatatataatctcatttcataaagctggacacgatttgactatccttataataattgattcacactttgactatacgatttcagattttgaaccttgcga |
199 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26844753 |
aatatataatcttatttcataaagctggacacgatttgactatccttataataattgattcacactttgactatacgatttcagtttttgaaccttgcga |
26844852 |
T |
 |
| Q |
200 |
gattctttggatctcaacaacagttatc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26844853 |
gattctttggatctcaacaacagttatc |
26844880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 26844654 - 26844713
Alignment:
| Q |
1 |
aaataaaattacaaaatctgtactttacgccacatttgatattgtagttaattcaaattg |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26844654 |
aaataaaattacaaaatctgtactttacgccacatttgatattgtagttaattcaaattg |
26844713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University