View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2608_low_25 (Length: 204)
Name: NF2608_low_25
Description: NF2608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2608_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 44870132 - 44869972
Alignment:
| Q |
18 |
gattcaatttcatatccgttatcatacatagacattacaatgttccgtacctatcaggttaggaaatgagaatccagagttgttttgagggcactgagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44870132 |
gattcaatttcatatccgttatcatacatagacattacaatgttccgtacctatcaggttaggaaatgagaatccagaattgttttgagggcactgagtt |
44870033 |
T |
|
| Q |
118 |
tgtagataaaaattgggaagactgggacccggcatcgacaaaagagcaggatcaaaattta |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44870032 |
tgtagataaaaattgggaagactgggacccggcatcgacaaaagagcaggatcaaaattta |
44869972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 78 - 139
Target Start/End: Complemental strand, 44859147 - 44859086
Alignment:
| Q |
78 |
aggaaatgagaatccagagttgttttgagggcactgagtttgtagataaaaattgggaagac |
139 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
44859147 |
aggaaatgagaatccagagttgttcttagggcactgagattgtagataaaaaatgggaagac |
44859086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 79 - 135
Target Start/End: Complemental strand, 44833795 - 44833739
Alignment:
| Q |
79 |
ggaaatgagaatccagagttgttttgagggcactgagtttgtagataaaaattggga |
135 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
44833795 |
ggaaataagaatccagagttgttttgagggcactgagtttgtagattaaaaatggga |
44833739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 135
Target Start/End: Complemental strand, 44846495 - 44846439
Alignment:
| Q |
79 |
ggaaatgagaatccagagttgttttgagggcactgagtttgtagataaaaattggga |
135 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
44846495 |
ggaaatgagtatccaaagttgtaccgagggcactgagtttgtagataaaaaatggga |
44846439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University