View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2608_low_27 (Length: 201)
Name: NF2608_low_27
Description: NF2608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2608_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 63 - 185
Target Start/End: Original strand, 17517636 - 17517758
Alignment:
| Q |
63 |
ttgatccaatcaaatggaaggnnnnnnnnntcttcattagataaaacttcattaaattcggctaggtgtgaataacattacctccctcttagttctcttg |
162 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17517636 |
ttgatccaatcaaatggaaggaaaaaaaattcttcattagataaaacttcattaaattcagctaggtgtcaataacattacctccctcttagttctcttg |
17517735 |
T |
 |
| Q |
163 |
tcttctgaattatttgacatgcc |
185 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
17517736 |
tcttctgaattaggtgacatgcc |
17517758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University