View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2608_low_27 (Length: 201)

Name: NF2608_low_27
Description: NF2608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2608_low_27
NF2608_low_27
[»] chr4 (1 HSPs)
chr4 (63-185)||(17517636-17517758)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 63 - 185
Target Start/End: Original strand, 17517636 - 17517758
Alignment:
63 ttgatccaatcaaatggaaggnnnnnnnnntcttcattagataaaacttcattaaattcggctaggtgtgaataacattacctccctcttagttctcttg 162  Q
    |||||||||||||||||||||         ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||    
17517636 ttgatccaatcaaatggaaggaaaaaaaattcttcattagataaaacttcattaaattcagctaggtgtcaataacattacctccctcttagttctcttg 17517735  T
163 tcttctgaattatttgacatgcc 185  Q
    ||||||||||||  |||||||||    
17517736 tcttctgaattaggtgacatgcc 17517758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University