View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2608_low_8 (Length: 323)
Name: NF2608_low_8
Description: NF2608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2608_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 32916074 - 32915782
Alignment:
| Q |
18 |
aaaaggtactacaatttatcctccagtaaattaattttaagtcttttgaaaattttgtgtttaatttgattcaaagagattgtttaaacatttgannnnn |
117 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32916074 |
aaaaggtactattgtttatccttcagtaaattaattttaagctttttgaagattttgtgtttaatttgattcaaagagattgtttaaacatttgattttt |
32915975 |
T |
|
| Q |
118 |
nnnnct-ttctttcagtgtgttgt-aggcagtgttagcaagcatgtggtgacaaatgcttcttgcccggttactgtagtcaagggaatgcaatcttccaa |
215 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32915974 |
tttcttcttctttcagtgtgttgttaggcagtgttagcaagcatgtggtaacaaatgcttcttgcccggttactgtagtcaagggaatgcaatcttccaa |
32915875 |
T |
|
| Q |
216 |
gtctaggcattgatttgatatgattattattaatatttactttgggtttgtttacatatgaaaaaataaataaatcacttaaagtactgtaccct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32915874 |
gtctaggcattgatttgatatgattattattaatatttactttgggtttgtttacatatg--aaaataaataaatcacttaaagtactgtaccct |
32915782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University