View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609-Insertion-10 (Length: 83)
Name: NF2609-Insertion-10
Description: NF2609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609-Insertion-10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 5e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 704903 - 704832
Alignment:
| Q |
8 |
caggcttccacgttgtacgtggttgggtgtgattcgttggaatcatcaaatcatttattcttacattgtcat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
704903 |
caggcttccacgttgtacgtggttgggtgtgattctttggaatcatcaaatcatttattcttacattgtcat |
704832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 26 - 76
Target Start/End: Original strand, 26260479 - 26260529
Alignment:
| Q |
26 |
gtggttgggtgtgattcgttggaatcatcaaatcatttattcttacattgt |
76 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26260479 |
gtggctgggtgtgattcgatggaatcatcaaatcatttattcttacattgt |
26260529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 40639155 - 40639116
Alignment:
| Q |
44 |
ttggaatcatcaaatcatttattcttacattgtcattttt |
83 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
40639155 |
ttggaatcatcaaatcatttatttttacattgtaattttt |
40639116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University