View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609-Insertion-13 (Length: 67)
Name: NF2609-Insertion-13
Description: NF2609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609-Insertion-13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 1e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 1e-27
Query Start/End: Original strand, 6 - 67
Target Start/End: Complemental strand, 32627261 - 32627200
Alignment:
| Q |
6 |
catttcaaacattagtattgatctttgctcgtttgtaaatatttcaaatgttaatttgatga |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32627261 |
catttcaaacattagtattgatctttgctcgtttgtaaatatttcaaatgttaatttgatga |
32627200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University