View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609R-Insertion-5 (Length: 230)
Name: NF2609R-Insertion-5
Description: NF2609R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609R-Insertion-5 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 50 - 230
Target Start/End: Complemental strand, 39385148 - 39384967
Alignment:
| Q |
50 |
atggaatttagacttctttctccgtgccaaagtctggagctgagtac-tcaaagttgaagaacaatcttacaaccaagtnnnnnnnctagcaggaattca |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
39385148 |
atggaatttagacttctttctccgtgccaaagtctggagctgagtacctcaaagttgaagaacaatcttacaaccaaataaaaaaactagcaggaattca |
39385049 |
T |
 |
| Q |
149 |
gacttctttgggtgttggatgaaatattttctgaaaatcacttcttcccttcacttggannnnnnnattaaaacaaagtcca |
230 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39385048 |
gacttctttgggtgttggatggaatattttctgaaaatcacttcttcccttcacttggatttttttattaaaacaaagtcca |
39384967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 59 - 127
Target Start/End: Original strand, 39180566 - 39180635
Alignment:
| Q |
59 |
agacttctttctccgtgccaaagtctggagctgagta-ctcaaagttgaagaacaatcttacaaccaagt |
127 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
39180566 |
agacttctttctcagtgccaaagtctggaactgagtacctcaaagttgaagaataatcttacaaccaagt |
39180635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University