View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609R-Insertion-7 (Length: 355)
Name: NF2609R-Insertion-7
Description: NF2609R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609R-Insertion-7 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 8 - 355
Target Start/End: Original strand, 12075868 - 12076215
Alignment:
| Q |
8 |
aaaacactaatatttcagttccaatacactcctctctgagtgctttcagatggtaattctccaaattctcgagtcaagcaaatcaccatctagaagcact |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12075868 |
aaaatactaatatttcagttccaatacactcctctct-agtgctttcagatggtgattctccaaatcctcgagtcaagcaaatcaccatctagaagcact |
12075966 |
T |
 |
| Q |
108 |
cagagcagagtgtactggagctgaaatattggggttttttcttcgcaaaggatcgagggtacacgagttgtgtcattgaagttaagaatgagctaactgt |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12075967 |
cagagcagagtgtattggagctgaaatattagggttttttcttcacaaaggatcgagggtacaccagttgtgtcattgaagttaagaatgagctaactgt |
12076066 |
T |
 |
| Q |
208 |
ccttggcct-aaatgaaaaaagtttaggaagttcccttttccacccctaaaccccgagctgttttcttgctgctcagggtttagggtttcattttgattg |
306 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
12076067 |
ccttggcctaaaatgaaaaaagtttaggaagtttccttttccacccctaaaccccgagctgttttcttgctgctcaaggtttaggatttcattttgattg |
12076166 |
T |
 |
| Q |
307 |
taaaccaacaccattttcagccagcaaacagcggcaagaaaatcaccat |
355 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12076167 |
taaaccaataccattttcagccagcaaacagcggcaagaaaatcaccat |
12076215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 12076004 - 12075951
Alignment:
| Q |
8 |
aaaacactaatatttcagttccaatacactcctctctgagtgctttcagatggt |
61 |
Q |
| |
|
||||| |||||||||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
12076004 |
aaaaccctaatatttcagctccaatacactctgctctgagtgcttctagatggt |
12075951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University