View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609R-Insertion-8 (Length: 390)
Name: NF2609R-Insertion-8
Description: NF2609R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609R-Insertion-8 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 107 - 390
Target Start/End: Complemental strand, 48332144 - 48331855
Alignment:
| Q |
107 |
aacaatttcttcttgattttagagtacatatttactattttacccatgctgctgc------agggaggtggtaggaaagatgttttcttttatcaagctg |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48332144 |
aacaatttcttcatgattttagagtacatatttactattttacccatgctgctgctgctgcagggaggtgataggaaagatgttttcttttatcaagctg |
48332045 |
T |
|
| Q |
201 |
atgatcaacattacataccccgtgctttattgattgacttggaaccaagggttattaatggaattcaaaatagtgattaccgtaatctctacaatcatga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48332044 |
atgatcaacattacataccccgtgctttattgattgacttggaaccaagggttattaatggaattcaaaatagtgattaccgtaatctctacaatcatga |
48331945 |
T |
|
| Q |
301 |
gaatatttttgttgctgatcatggtggtggtgctggtaacaattgggctagtggctaccatcaggtatgcttactttaatccatgtctgt |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48331944 |
gaatatttttgttgctgatcatggtggtggtgctggtaacaattgggctagtggctaccatcaggtatgcttactttaatccatgtctgt |
48331855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 48332224 - 48332156
Alignment:
| Q |
9 |
gaaacaactctgtctcgaacatggtatcagcaaagacggcatcctcgaagatttcgctactcaggttca |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48332224 |
gaaacaactctgtctcgaacatggtatcagcaaagacggcatcctcgaagatttcgctactcaggttca |
48332156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University