View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609R-Insertion-9 (Length: 445)
Name: NF2609R-Insertion-9
Description: NF2609R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609R-Insertion-9 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 265 - 445
Target Start/End: Original strand, 30550706 - 30550886
Alignment:
| Q |
265 |
tattacttatctgataatagatt----gctgttacaagtttacaacataaatgcaatcatatatagacattgcttaaagatcaagttttatatattgata |
360 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30550706 |
tattacttatctgataatagattaattgctgttacatgtttacaacataaatgcaatcatatatagacattgcttaaagatcaagttttatatattgata |
30550805 |
T |
 |
| Q |
361 |
aaaacattaattacaagtggaatttaattttgatcactagtatcatcatcttcttcttcagctattgaaacaatttcccctatgc |
445 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30550806 |
aaaac----attacaagtggaatttaattttgatcactagtatcatcatcttcttcttcagctattgaaacaatttcccctatgc |
30550886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 30550633 - 30550682
Alignment:
| Q |
8 |
acttttaaattattcatgat-gtgtccatatactttataaaattatgctg |
56 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30550633 |
acttttaaattattcatgattgtgtccatatactttataaaattatgctg |
30550682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University