View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609_low_1 (Length: 548)
Name: NF2609_low_1
Description: NF2609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 8e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 8e-81
Query Start/End: Original strand, 257 - 481
Target Start/End: Complemental strand, 5596227 - 5596018
Alignment:
| Q |
257 |
tttcattgattttaaatacccaaaacctttctcttttccctcctttctgttgaatttaaatacccttttgttgattcttgatcaatcaagcaaaaagttc |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5596227 |
tttcattgattttaaatacccaaaacctctctcttttccctcctttctgttgaatttaaatacccttttgttgattcttgatcaatcaagcaaaaagttc |
5596128 |
T |
 |
| Q |
357 |
cctcctttttgttgattttatatacccttttgccaagagttcttcactctgtgttgattttccggtgtgtcagagtatcaaaccta-atcatcaagttga |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||| |
|
|
| T |
5596127 |
cctcctttttgttgattttatatacccttttgccaagagttcttcact----------------ttgtgtcagagtatcgaacctagatcatcaagttga |
5596044 |
T |
 |
| Q |
456 |
aaacttgttattgattttagataccc |
481 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5596043 |
aaacttgttattgattttagataccc |
5596018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 111 - 213
Target Start/End: Complemental strand, 5596378 - 5596271
Alignment:
| Q |
111 |
ttcaaaccatgaaaactttact----aaaccagggtacaaggaaccggg-aacttcactagggcatagggaagcgggaacctgaaagtaaacgatcttat |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
5596378 |
ttcaaaccatgaaaactttacttactaaaccagggtacaaggaaccggggaacttcactagggcatagggaagcgggaacctgaaaatatacgatcttat |
5596279 |
T |
 |
| Q |
206 |
ccgattat |
213 |
Q |
| |
|
|||||||| |
|
|
| T |
5596278 |
ccgattat |
5596271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University