View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609_low_5 (Length: 252)
Name: NF2609_low_5
Description: NF2609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 23 - 109
Target Start/End: Complemental strand, 44019331 - 44019245
Alignment:
| Q |
23 |
ccaggatagtttcgtcgaaaaaggagcatgagatcgagtgagcagattatgtacgaatgtcttctcctcatggggtttgtcttagat |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44019331 |
ccaggacagtttcgtcgaaaaaggagcaggagaccgagtgagcagattatgtacgaatgtcttcttctcatggggtttgtcttagat |
44019245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 216 - 252
Target Start/End: Complemental strand, 44019138 - 44019102
Alignment:
| Q |
216 |
gcaaataagtgttttcgtaactaaaaagcaattttct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44019138 |
gcaaataagtgttttcgtaactaaaaagcaattttct |
44019102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University