View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2609_low_7 (Length: 245)
Name: NF2609_low_7
Description: NF2609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2609_low_7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 44018539 - 44018776
Alignment:
| Q |
18 |
gaatgaaatgcagaatgagacgattgagtttttattatatgagaaaagcagaaggttcttggaatgttggtggaaataacgtagcaaataactagaatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44018539 |
gaatgaaatgcagaatgagacgattgagtttttattatatgagaaaagcagaaggttcttggaatgttggtggaaataacgtagcaaataactagaatat |
44018638 |
T |
 |
| Q |
118 |
----------atatgatgcaaagacttcgacatcaacgaccattctaagtcaacatcccttccctattggaaaaaagatatacaagctgaaaagcatgta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44018639 |
atatatatatatatgatgcaaagacttcgacatcaacggccattctaagtcaacttcccttccctattggaaaaaagatatacaagctgaaaagcatgta |
44018738 |
T |
 |
| Q |
208 |
ggacccaaaaatttaatttcaaatgcccccttgttatt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44018739 |
ggacccaaaaatttaatttcaaatgcccccttgttatt |
44018776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University