View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2610_high_15 (Length: 319)
Name: NF2610_high_15
Description: NF2610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2610_high_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 315; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 315; E-Value: 1e-178
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 10318788 - 10318470
Alignment:
| Q |
1 |
ttatcaattccaataagtatagaaaagaatttagagacatgaagcttttcaagtggaaatttgggaagcagtacctcattactcaggatttgtgcaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10318788 |
ttatcaattccaataagtatagaaaagaatttagagacatgaagcttttcaagtggaaatttgggaagcagtacctcattactcaggatttgtgcaaccg |
10318689 |
T |
 |
| Q |
101 |
ctatgatacggcttggaaggaagatagatggcttcttttcaacaaaatccatgaaaagaaagtttcagatgctgcaacaaagtatgagaagaaattaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10318688 |
ctatgatacggcttggaaggaagatagatggcttcttttcaacaaaatccatgaaaagaaagtatcagatgctgcaacaaagtatgagaagaaattaata |
10318589 |
T |
 |
| Q |
201 |
gatttactttcgaggaattcagaagtatcagaatcactcgaagctaagcttctttcaagttcaatattggtttgttctaaggactatcaggtgaggagaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10318588 |
gatttactttcgaggaattcagaagtatcagaatcactcgaagctaagcttctttcaagttcaatattggtttgttctaaggactatcaggtgaggagaa |
10318489 |
T |
 |
| Q |
301 |
gaatagggaatggaagtca |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10318488 |
gaatagggaatggaagtca |
10318470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University