View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2610_high_20 (Length: 277)
Name: NF2610_high_20
Description: NF2610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2610_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 2429303 - 2429557
Alignment:
| Q |
14 |
aaatttaatgtaggattttcataaccaagtggccatggttgatgaggactgtttaccaaaaattttcgatctgttcaacattcaacatcagggtatgcgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429303 |
aaatttaatgtaggattttcataaccaagtggccatggttgatgaggactgtttaccaaaaattttcgatctgttcaacattcaacatcagggtatgcgg |
2429402 |
T |
|
| Q |
114 |
aaagcagttcgtgggcttctcttcaattttgtcaacaataaggtatttttatatgactgaaaatttaaataaactatttttcaatttcaaagcaaggtaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429403 |
aaagcagttcgtgggcttctcttcaattttgtcaacaataaggtatttttatatgactgaaaatttaaataaactatttttcaatttcaaagcaaggtaa |
2429502 |
T |
|
| Q |
214 |
atgatggtcaaannnnnnnnctcttcccgtgtaggttgtaatatcccagttcatc |
268 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429503 |
atgatggtcaaattttttttctcttcccgtgtaggttgtaatatcccagttcatc |
2429557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 165 - 194
Target Start/End: Complemental strand, 1512344 - 1512315
Alignment:
| Q |
165 |
tatgactgaaaatttaaataaactattttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1512344 |
tatgactgaaaatttaaataaactattttt |
1512315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University