View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2610_high_23 (Length: 250)
Name: NF2610_high_23
Description: NF2610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2610_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 28179673 - 28179435
Alignment:
| Q |
1 |
tcacctttagaccaaaaagataccagcttgaacataaaacatgtctcgatcgcatcattttcatgaactacttcaatcatccatcgtcttcgcaatccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28179673 |
tcacctttagaccaaaaagataccagcttgaacataaaacatgtctcgatcgcatcattttcatgaacgacttcaatcatccatcgtcttcgcaatccaa |
28179574 |
T |
 |
| Q |
101 |
taactttctctttttacaaggatcggtgaattgaatatccgtcatgctactttacggctttaatacatggattccaaattctataggtgataccattatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28179573 |
taactttctctttttacaaggatcggtgaattgaatatccgtcatgctactttacggctttaatacatggattccaaattctataggtgataccattatc |
28179474 |
T |
 |
| Q |
201 |
aaagacacacacatgtaatctccacattgatccattcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28179473 |
aaagacacacacatgtaatctccacattgatccattcat |
28179435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 28155085 - 28154929
Alignment:
| Q |
18 |
agataccagcttgaacataaaacatgtctcgatcgcatcattttcatgaactacttcaatcatccatcgtcttcgcaatccaataactttctctttttac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
28155085 |
agataccagcttgaacataaaacatgtctcgatagcatcatgctcatgaactactgcaatcatc----gtcttcgcaatccaataattttctctttttac |
28154990 |
T |
 |
| Q |
118 |
aaggatcggtgaattgaatatccgtcatgctactttacggctttaatacatggattccaaa |
178 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
28154989 |
aaggatcggtgaattgaatatccgccatgctacttttctgctttaatacatggattccaaa |
28154929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University