View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2610_low_12 (Length: 461)
Name: NF2610_low_12
Description: NF2610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2610_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 10 - 402
Target Start/End: Complemental strand, 40752644 - 40752234
Alignment:
| Q |
10 |
aatatggtgcccaaaattggaattcaattgctgaaaaactccaaggaagatcaggtatgtattatgcaataatattaattaaagctttattattaattga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752644 |
aatatggtgcccaaaattggaattcaattgctgaaaaactccaaggaagatcaggtatgtattatgcaataatattaattaaagctttattattaattga |
40752545 |
T |
 |
| Q |
110 |
tttagtttggggagtgcttgctgctgtt------------------cttggggtgaccttctgtgcacgtttcatgctgctgtcttttaatcccagggag |
191 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752544 |
ttttgtttggggagtgcttgctgctgttagctgatcttatgctgttcttggggtgaccttctttgcacgtttcatgctgctgtcttttaatcccagggag |
40752445 |
T |
 |
| Q |
192 |
gttctgttatagaggagggagnnnnnnnnnnnnnnngtgggctatgttttggataggctatgtctgctgtcttcaaattcatagtgaaattaatatagtt |
291 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752444 |
gttctgttatagaggagggagtttttttctttttttgtgggctatgttttggataggctatgtctgctgtcttcaaattcatagtgaaattaatatagtt |
40752345 |
T |
 |
| Q |
292 |
gatttttgatctcttcaattcatcttgtactcaactaataaaattttaattggtagaaaattaaactgatattgtttccaccaattaattatctcatgta |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752344 |
gatttttgatctcttcaattcatcttgtactcaactaataatattttaattggtagaaaattaaactgatattgtttccaccaattaattatctcatgta |
40752245 |
T |
 |
| Q |
392 |
ctcttgtatat |
402 |
Q |
| |
|
||||||||||| |
|
|
| T |
40752244 |
ctcttgtatat |
40752234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University