View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2610_low_15 (Length: 381)
Name: NF2610_low_15
Description: NF2610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2610_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 143 - 375
Target Start/End: Original strand, 40311434 - 40311667
Alignment:
| Q |
143 |
ttccaactggttatatccatgtcagagcaagaaggggtcaggcaacagatagccacagccttgctgaaagggtatgcaatacagtttttacctatgaagc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311434 |
ttccaactggttatatccatgtcagagcaagaaggggtcaggcaacagatagccacagccttgctgaaagggtatgcaatacagtttttacctatgaagc |
40311533 |
T |
|
| Q |
243 |
cctaacagggacacaaacgccgaatgtaataacatg-tgttaatgtgtagccggacaaaagtgtcggagctacttaggttattacaatttacaactgaaa |
341 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311534 |
cctaacacggacacaaacgccgaatgtaataacatgccgttagtgtgtagccggacaaaagtgtcggagctacttaggttattacaatttacaactgaaa |
40311633 |
T |
|
| Q |
342 |
gggaattcctcaattgcctcaaagttcatctctc |
375 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
40311634 |
gggaattcctcaattgcctcaaagttcatgtctc |
40311667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 7 - 35
Target Start/End: Original strand, 40311298 - 40311326
Alignment:
| Q |
7 |
gttactttgtggtatttgtaggatatctc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40311298 |
gttactttgtggtatttgtaggatatctc |
40311326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 145 - 216
Target Start/End: Original strand, 45175752 - 45175823
Alignment:
| Q |
145 |
ccaactggttatatccatgtcagagcaagaaggggtcaggcaacagatagccacagccttgctgaaagggta |
216 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
45175752 |
ccaactggctatatccacgtccgagcaagaaggggtcaggccactgatagccacagccttgctgaaagggta |
45175823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University