View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2610_low_18 (Length: 372)
Name: NF2610_low_18
Description: NF2610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2610_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 52 - 230
Target Start/End: Complemental strand, 23687164 - 23686985
Alignment:
| Q |
52 |
tgtgagagtgaaagaggtttaggatttgagtttcgggtaggtgtgggtgtgtgatttgttggtaaaatttatttatttatatnnnnnnn-ctcattgtct |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23687164 |
tgtgagagtgaaagaggtttaggatttgagtttcaggtaggtgtgggtgtgtgatttgttggtaaaatttatttatttatataaaaaaaactcattgtct |
23687065 |
T |
 |
| Q |
151 |
atttgtggttggcttttgactcatcaatttttcccttcagtccttttcaataaattgataaactaaaattgatatgattg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23687064 |
atttgtggttggcttttgactcatcaatttttcccttcggtccttttcaataaattgataaactaaaattgatatgattg |
23686985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University