View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2610_low_38 (Length: 248)
Name: NF2610_low_38
Description: NF2610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2610_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 24 - 235
Target Start/End: Original strand, 10318282 - 10318493
Alignment:
| Q |
24 |
ttttgctcatcagttccatcaacagaaaacattctttcttctcctcatcagtaaaaccacaaagacagtccattatatttggatgtgaaagagataaaag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10318282 |
ttttgctcatcagttccatcaacagaaaacattctttcttctcctcatcagtaaaaccacaaagacagtccattatatttggatgtgaaagagataaaag |
10318381 |
T |
 |
| Q |
124 |
ttctttaatctcactttccaaagcatcagtgtcaccagaacattgtcttaaaacaaaatattcacctaaccattgaatctctttgtactgacttccattc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10318382 |
ttctttaatctcactttccaaagcatcagtgtcaccagaacattgtcttaaaacaaaatattcacctaaccattgaatctctttgtactgacttccattc |
10318481 |
T |
 |
| Q |
224 |
cctattcatctc |
235 |
Q |
| |
|
||||||| |||| |
|
|
| T |
10318482 |
cctattcttctc |
10318493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University