View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2610_low_46 (Length: 228)
Name: NF2610_low_46
Description: NF2610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2610_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 11874079 - 11874240
Alignment:
| Q |
1 |
cctttttctataactttatgactacacaaaatttcatattccgattgcgacaaaccaaataactctcatctcaaagtaaaaccatttttgcttggactac |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11874079 |
cctttttctataactttataactacacaaaatttcatattcggattgcgacaaatcaaataaagctcatctcaaagtaaaaccatttttgcttggactac |
11874178 |
T |
 |
| Q |
101 |
aaacacaatcaaccaaaacctaaatgaaattgtattaacaaaagttataataataacaattt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11874179 |
aaacacaatcaaccaaaacctaaatgaaattgtattaacaaaagttataataataacaattt |
11874240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University