View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2611_high_14 (Length: 256)
Name: NF2611_high_14
Description: NF2611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2611_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 43170247 - 43170467
Alignment:
| Q |
19 |
acctgtaagaaaagtgagctacttatcggattttgtgcaaccacctcattgtcgaccatgatgcaaaagggaaataaaatacattgatactgctagaagt |
118 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43170247 |
acctgtaagaaaagtgagctgcttatcggattttgcgcaaccaccttaatgtcgaccatgatgcaaaagggaaataaaatacattgatgctgctagaagt |
43170346 |
T |
 |
| Q |
119 |
tgaaatgcagcgttgcaaatgacacatttatagtgttgtgcagagtttgttatgaacaggttggattccatgctctcttgccatggatttctttccaact |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43170347 |
tgaaatgcagcgttacaaatgacacatttatagtgttgtgcagagtttgttatgaacaggttggattccatgctctcttgccatggatttctttccaact |
43170446 |
T |
 |
| Q |
219 |
tttttcaactgccttccacag |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43170447 |
tttttcaactgccttccacag |
43170467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University