View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2611_high_16 (Length: 247)
Name: NF2611_high_16
Description: NF2611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2611_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 52993252 - 52993048
Alignment:
| Q |
1 |
tttactcagttgcttctggtttgctactattgctttcatttctcaaatttgtgtaccctcccttcaaatatgttgctcttgctgctgttgttgccggcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52993252 |
tttactcagttgcttctggtttgctactattgctttcatttctcaaatttgtgtacactcccttcaaatatgttgctcttgctgctgttgttgccggcat |
52993153 |
T |
 |
| Q |
101 |
ttatccaatcttcttgaaagctattgtttccattcggaatcttagaattgacattaacattcttgtcatcatagcaggtataatttcatttgcttaatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52993152 |
ttatccaatcttcttgaaagctattgtttccattcggaatcttagaattgacattaacattcttgtcatcatagcaggtataatttcatttgcttaatac |
52993053 |
T |
 |
| Q |
201 |
tataa |
205 |
Q |
| |
|
||||| |
|
|
| T |
52993052 |
tataa |
52993048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University