View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2611_low_10 (Length: 322)
Name: NF2611_low_10
Description: NF2611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2611_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 15 - 299
Target Start/End: Original strand, 48331854 - 48332144
Alignment:
| Q |
15 |
gacagacatggattaaagtaagcatacctgatggtagccactagcccaattgttaccagcaccaccaccatgatcagcaacaaaaatattctcatgattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48331854 |
gacagacatggattaaagtaagcatacctgatggtagccactagcccaattgttaccagcaccaccaccatgatcagcaacaaaaatattctcatgattg |
48331953 |
T |
|
| Q |
115 |
tagagattacggtaatcactattttgaattccattaataacccttggttccaagtcaatcaataaagcacggggtatgtaatgttgatcatcagcttgat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48331954 |
tagagattacggtaatcactattttgaattccattaataacccttggttccaagtcaatcaataaagcacggggtatgtaatgttgatcatcagcttgat |
48332053 |
T |
|
| Q |
215 |
aaaagaaaacatctttcctatcacctccct------gcagcagcatgggtaaaatagtaaatatgtactctaaaatcaagaagaaattgtt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48332054 |
aaaagaaaacatctttcctatcacctccctgcagcagcagcagcatgggtaaaatagtaaatatgtactctaaaatcatgaagaaattgtt |
48332144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University