View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2611_low_20 (Length: 236)
Name: NF2611_low_20
Description: NF2611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2611_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 4 - 222
Target Start/End: Original strand, 42272696 - 42272914
Alignment:
| Q |
4 |
tcatcattgagttggtttgagattaatgcaagcaaacaaaaaacgagttttattacccaaaccaaacaaacttgattaggtcgggttgaatgtttggcca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272696 |
tcatcattgagttggtttgagattaatgcaagcaaacaaaaaacgagtttttttacccaaaccaaacaaacttgattaggtcgggttgaatgtttggcca |
42272795 |
T |
 |
| Q |
104 |
taacctaccccaccaaactcaggaacatccctaaaggagactacccagttaaaagtggctgcagagtttgtgtgggacacttagtgaatccatatgcgaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272796 |
taacctaccccaccaaactcaggaacatccctaaaggagactacccagttaaaagtggctgcagagtttgtgtgggacacttagtgaatccatatgcgaa |
42272895 |
T |
 |
| Q |
204 |
gacttgtgcggaatattct |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42272896 |
gacttgtgcggaatattct |
42272914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University