View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2611_low_21 (Length: 235)
Name: NF2611_low_21
Description: NF2611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2611_low_21 |
 |  |
|
| [»] scaffold0056 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0056 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 21 - 221
Target Start/End: Original strand, 69336 - 69536
Alignment:
| Q |
21 |
atattttattattgaaaagtaaaacagaagaagtgaaaaacgtccatgtacaggacccatgtgtagaaaagggaaaaattgaaatttaggatgtcatttc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||| |||||||||||||||||||||| |
|
|
| T |
69336 |
atattttattattgaaaagtaaaacagaagaagtgaaaaacgtccatgtacaggacccatgtgcagaacaaggaaaatttgaaatttaggatgtcatttc |
69435 |
T |
 |
| Q |
121 |
aacccaaattgaaattgaaattgtaacgaaatacgaaaattatcatgcaatcttttcatctctagtctattgtgtgattttaaatccgcaccgtggtatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
69436 |
aacccaaattgaaattgaaattgtaacgaaatacgaaaattatcatgcaatcttttcatctcttgtctatggtgtgattttaaatccgcaccctggtatt |
69535 |
T |
 |
| Q |
221 |
t |
221 |
Q |
| |
|
| |
|
|
| T |
69536 |
t |
69536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University