View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2611_low_8 (Length: 367)
Name: NF2611_low_8
Description: NF2611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2611_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 52993210 - 52993048
Alignment:
| Q |
1 |
tcaaatttgtgtaccctcccttcaaatatgttgctcttgctgctgttgttgccggcatttatccaatcttcttgaaagctattgtttccattcggaatct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52993210 |
tcaaatttgtgtacactcccttcaaatatgttgctcttgctgctgttgttgccggcatttatccaatcttcttgaaagctattgtttccattcggaatct |
52993111 |
T |
 |
| Q |
101 |
tagaattgacattaacattcttgtcatcatagcaggtataatttcatttgcttaatactataa |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52993110 |
tagaattgacattaacattcttgtcatcatagcaggtataatttcatttgcttaatactataa |
52993048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 206 - 330
Target Start/End: Complemental strand, 52993010 - 52992886
Alignment:
| Q |
206 |
gttcccaaacatgtgaaagggtattatttcatactacttaagttggtttactagttgaccaattttcaaattgttaattttattgagattcaaataaaaa |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52993010 |
gttcccaaacatgtgaaagggtattatttcatactacttaagttggtttactagttgaccaattttcaaattgttaattttattgagattcaaataaaag |
52992911 |
T |
 |
| Q |
306 |
ccgttgcttttgctcataaaactcg |
330 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
52992910 |
ccgttgcgtttgctcataaaactcg |
52992886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University