View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2611_low_9 (Length: 353)
Name: NF2611_low_9
Description: NF2611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2611_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 17 - 193
Target Start/End: Complemental strand, 50631395 - 50631219
Alignment:
| Q |
17 |
aagtgattgttttgtcaacttcaattaaatttctttgtcgggtcagagatagtgagaggaagaatcacatgtctatagctattccatagcacttatctat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50631395 |
aagtgattgttttgtcaacttcaattaaatttctttgtcgggtcagggatagtgagatgaagaatcacatgtctatagctattccatagcacttatctat |
50631296 |
T |
|
| Q |
117 |
atatacagtccaaattggcatgattgtatctcaactgaaactggcaagagtcacaccaacattgaagtgggaattta |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50631295 |
atatacagtccaaattggcatgattgtatctcaactgaaactggcaagagtcacaccaacattgaagtgggaattta |
50631219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 258 - 343
Target Start/End: Complemental strand, 50631102 - 50631019
Alignment:
| Q |
258 |
acacaacaatgtgcattttatttaaaaatttcttcattttgagtttaaaaattatacatacttcaattgtaaatacagatattcat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50631102 |
acacaacaatgtgcattttatttaaaaatttcttcattttgagtttaaaaat--tacatacttcaattgtaaatacagatattcat |
50631019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University