View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2612_low_4 (Length: 240)
Name: NF2612_low_4
Description: NF2612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2612_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 118 - 222
Target Start/End: Complemental strand, 454750 - 454649
Alignment:
| Q |
118 |
tttgtgaatatgaagagatggagaaaagttcacgagagggggagtatatcccccgtgattaagtatctaaagaagaatccaaaaatccaaatgtatacca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
454750 |
tttgtgaatatgaagagatggagaaaagttcacgagaggg--agtatatcccc-gtgagtaagtatctaaagaagaatccaaaaatccgaatgtatacca |
454654 |
T |
 |
| Q |
218 |
ctttc |
222 |
Q |
| |
|
||||| |
|
|
| T |
454653 |
ctttc |
454649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University