View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2612_low_6 (Length: 233)
Name: NF2612_low_6
Description: NF2612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2612_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 43255112 - 43255318
Alignment:
| Q |
15 |
ggccaatatatttttctatttgatttgttgattaactttctgtcnnnnnnnnnnnnnnn--tttgattattgtcctctcttttgttgcaattgaaaattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43255112 |
ggccaatatatttttctatttgatttgttgattaactttctgtcaaaaaaaaaaaaaaaaatttgattattgtcctctcttttgttgcaattgaaaattt |
43255211 |
T |
 |
| Q |
113 |
attacttgtcagaatcaacatgttaaaatactcacctgatatgtatctttagaatcctccgaatattaatttgatatgttgaatcatatgcagagaaatg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43255212 |
attacttgtcagaatcaacatgttaaaatactccccttatatgtatctttagaatcctccgaatattaatttgatatgttgaatcatatgcagagaaatg |
43255311 |
T |
 |
| Q |
213 |
gagtatc |
219 |
Q |
| |
|
||||||| |
|
|
| T |
43255312 |
gagtatc |
43255318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University