View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2614_high_4 (Length: 243)
Name: NF2614_high_4
Description: NF2614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2614_high_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 51417490 - 51417716
Alignment:
| Q |
17 |
gttttgtggaggtggaatcacggttttccctcacaaactcatcattgcttgagcaattttgttacacttagg---taacatatatatttagatcacatga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51417490 |
gttttgtggaggtggaatcacggttttccctcacaaactcatcattgcttgagcaattttgttacacttaggttttaacatatatatttagatcacatga |
51417589 |
T |
|
| Q |
114 |
aggctccaatttnnnnnnnnnnnnnnnnnnnntcatttcaattcaacctttatgtttgcatctcttaacagagatattaatttatttcaactctcataac |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51417590 |
aggctccaatttaaaaaaaaaaaaaaaaaa---catttcaattcaacctttatgtttgcatctcttaacagagatattaatttatatcaactctcataac |
51417686 |
T |
|
| Q |
214 |
aatatgtgggtcagagataacaaagtctcc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51417687 |
aatatgtgggtcagagataacaaagtctcc |
51417716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 125
Target Start/End: Original strand, 29323126 - 29323225
Alignment:
| Q |
17 |
gttttgtggaggtggaatcacggttttccctcacaaactcatcattgcttgagcaattttgttacacttaggtaacatatatatttagatcacatgaagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
29323126 |
gttttgtggaggtggaatcacggttttccctcacaaactcatcattgcttgagcaattttgttac---------acatgtatatttagatcacatgaagg |
29323216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 29323291 - 29323375
Alignment:
| Q |
159 |
acctttatgtttgcatctcttaacagagatattaatttatttcaactctcataacaatatgtgggtcagagataacaaagtctcc |
243 |
Q |
| |
|
||||||||||||| || ||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29323291 |
acctttatgtttgtctcctttaacagagttattaatttctttcacctctcataacaatatgtgggtcagagataacaaagtctcc |
29323375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University