View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2614_low_2 (Length: 356)
Name: NF2614_low_2
Description: NF2614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2614_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 352
Target Start/End: Complemental strand, 9186644 - 9186307
Alignment:
| Q |
17 |
attacgtagaagagttcaagaaacataatctgctgctatcaagctgttttgtttatttcagttattgtatatttgtgattcatatagtatagttttattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9186644 |
attacgtagaagagttcaagaaacataatctgct---atcaagctgttttgtttatttcagttattgtatatttgtgattcatatagtatagttttattt |
9186548 |
T |
 |
| Q |
117 |
catttggatgggtcaatgtgcatcacgtagaaaaattcatagcggaggagaggttggaggtgatggtggaggagaatctgtttattcacaaaggcat--- |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9186547 |
catttggatgggtcaatgtgcatcacgtagaaaaattcatagcggaggagaggttggaggtgatggtggaggagaatctgtttattcacaaaggcatggt |
9186448 |
T |
 |
| Q |
214 |
---ggatgttttgctatggtaaaggagcataagtccaggttctatattgttagaagatgtataatgattctaatttgttggcataaatatgatcattaag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9186447 |
ggaggatgttttgctatggtaaaggagcataagtccaggttctatattgttagaagatgtataatgattctaatttgttggcataaatatgatca-taag |
9186349 |
T |
 |
| Q |
311 |
tattgagatcatgaataatcttcttttttgtttcttctctct |
352 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
9186348 |
tattgagatcatgaataatcttattttttgtttcttttctct |
9186307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University