View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2615_high_13 (Length: 288)
Name: NF2615_high_13
Description: NF2615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2615_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 12 - 277
Target Start/End: Original strand, 40153988 - 40154253
Alignment:
| Q |
12 |
agaaacaacctgacgaagtcacgcactctggttgtgcaagaagaggccgttcaaaccgccatcgttcagaaccgaccttaggacttgaccggaaggagcg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40153988 |
agaaacaacctgacgaagtcacgcactctggttgtgcaagaagaggccgttcaaaccgccatcgttcagacccgaccttaggacttgaccggaaggagcg |
40154087 |
T |
|
| Q |
112 |
tgtacggggctccaccggagataacttgtaggatccgagttgtggcggaggtttgagcttgaatgagggagattccgggttttgatgatgatggtgagga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40154088 |
tgtacggggctccaccggagataacttgtaggatccgagttgtggcggaggtttgagcttgaatgagggagattccgggttttgatgatgatggtgagga |
40154187 |
T |
|
| Q |
212 |
atggggagtcctggtttgatttcccatttgaatggaactgatcctggttttttgaaagaataatct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40154188 |
atggggagtcctggtttgatttcccatttgaatggaactgatcctggttttttgaaagaataatct |
40154253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University