View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2615_high_16 (Length: 246)
Name: NF2615_high_16
Description: NF2615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2615_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 88 - 228
Target Start/End: Original strand, 51827450 - 51827593
Alignment:
| Q |
88 |
ggttaaactatttaacactgcgatttctcttata---tttactaatatttacgttgatttagcacctaacacaagccatggagcggattcagcatgcttt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51827450 |
ggttaaactatttaacactgcgatttctcttatactatttactaatatttacgttgatttagcacctaacacaagccatggagcggattcagcatgcttt |
51827549 |
T |
 |
| Q |
185 |
tctggagcagcagagtcaggacagattctttgatatggtgagta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51827550 |
tctggagcagcagagtcaggacagattctttgatatggtgagta |
51827593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 51827365 - 51827417
Alignment:
| Q |
9 |
cttaggaactgcacaaattgtaaaatgagaactagctaattaagaggccgatc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51827365 |
cttaggaactgcacaaattgtaaaatgagaactagctaattaagaggccgatc |
51827417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 88 - 176
Target Start/End: Original strand, 51824200 - 51824288
Alignment:
| Q |
88 |
ggttaaactatttaacactgcgatttctcttatatttactaatatttacgttgatttagcacctaacacaagccatggagcggattcag |
176 |
Q |
| |
|
|||||||||| |||| ||||| ||| |||| ||||||||| ||||||||||||||||||||||||| ||||| ||| ||| |||||||| |
|
|
| T |
51824200 |
ggttaaactacttaaaactgcaattgctctcatatttactgatatttacgttgatttagcacctaaaacaagtcattgagtggattcag |
51824288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University