View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2615_low_19 (Length: 240)
Name: NF2615_low_19
Description: NF2615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2615_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 26310335 - 26310542
Alignment:
| Q |
13 |
aaggtgcataagtctagctacttagcattcttt---gtaaaattgaaaaaagaaagtaatttaatttaatcaattttgttccaagttttgagcattatgt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
26310335 |
aaggtgcataagtctagctacttagcattcttttttgtaaaattgaaaaaagaaagtaatttaatttaatcaaatttgttccaaggtttgagcattatgt |
26310434 |
T |
 |
| Q |
110 |
ttctaatagtttgtaaattggtgaactcattaacttgagttggaatcctcgatcacgacgtttggtataataattttgggatttttatcaattgaaccga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
26310435 |
ttctaatagtttgtaaattggtgaactcattaacttgagttggaatcctcgatcacgacgtttggtataataattttgggatttttatcagttgagccga |
26310534 |
T |
 |
| Q |
210 |
gatttgtg |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
26310535 |
gatttgtg |
26310542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 139
Target Start/End: Complemental strand, 47931567 - 47931487
Alignment:
| Q |
59 |
aagaaagtaatttaatttaatcaattttgttccaagttttgagcattatgtttctaatagtttgtaaattggtgaactcat |
139 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| | | ||| ||| | |||||| |||||||| || ||||||||||||||| |
|
|
| T |
47931567 |
aagaaagtcatttaatttaatcacttttgttttatgattttagcctcatgtttttaatagttagtcaattggtgaactcat |
47931487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University