View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2615_low_20 (Length: 233)
Name: NF2615_low_20
Description: NF2615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2615_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 12 - 122
Target Start/End: Original strand, 34273431 - 34273541
Alignment:
| Q |
12 |
tgttgatgattttatgttataagtaagcgcaacaagtaataaaaacctaagtaatccctaatgcatatggagttgttgaatttataataaatcaacttat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34273431 |
tgttgatgattttatgttataagtaagcgcaacaagtaataaaaacctaagtaatccctaatgcatatggagttgttgaatttataataaatcaacttat |
34273530 |
T |
 |
| Q |
112 |
atcacttaatg |
122 |
Q |
| |
|
||||||||||| |
|
|
| T |
34273531 |
atcacttaatg |
34273541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 34273600 - 34273651
Alignment:
| Q |
182 |
ctttttattaactcattatggaaaagttggggccttgagttggcggaggttg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34273600 |
ctttttattaactcattatggaaaagttggggccttgagttggcggaggttg |
34273651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University