View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2615_low_22 (Length: 229)
Name: NF2615_low_22
Description: NF2615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2615_low_22 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 26309646 - 26309876
Alignment:
| Q |
1 |
acaaatcaatgagattgattgataccatcaataaaaaagaacgattttactatatgatcaacata--tatagtaacattttactgtatcagcgtataact |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |||||| ||||| |
|
|
| T |
26309646 |
acaaatcaatgagattgattgataccatcaataaaaaagaacgattttactatatgatcaacatacatatagtaacattttagtgtaccagcgtttaact |
26309745 |
T |
|
| Q |
99 |
ctccatgattacgttttaaatggcagatactttgttaattgctaatggaaatcaaataattatggaatattatttacttacttttgactcaatatataag |
198 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26309746 |
ctacatgattacgttttaaatggcagatactttcttaattgctaatggaaatcaaataattatggaatattatttacttacttttgactcaatatataag |
26309845 |
T |
|
| Q |
199 |
ggtccagttgaccgtcttgtacaactcgttt |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
26309846 |
ggtccagttgaccttcttgtacaactcgttt |
26309876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University