View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2615_low_24 (Length: 210)
Name: NF2615_low_24
Description: NF2615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2615_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 40433385 - 40433208
Alignment:
| Q |
16 |
taggcaaagcatcttgttgttgcgtcttttgtcttagccattgttctgctttattgcactcatcgattatctaaaacatggaagttgttacttgaaagct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40433385 |
taggcaaagcatcttgttgttgcgtcttttgtcttagccattgttctgctttattgcactcatcgattatctaaaacatgaaagttgttacttgaaagct |
40433286 |
T |
 |
| Q |
116 |
gatattaagagctgcatctcaaaataatatttattctcctatttaatgtaccagttctttattttcttgtggaagaga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40433285 |
gatattaagagctgcatctcaaaataatatttattctcctatttaatgtaccagttctttattttcttgtggaagaga |
40433208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University