View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2615_low_25 (Length: 202)
Name: NF2615_low_25
Description: NF2615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2615_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 3e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 29644194 - 29644338
Alignment:
| Q |
1 |
cttcaattaactttgttggttctttcagactttgtcatcatgggcgacttcaagcgtcgaagaagttgcttcaactggacctggaatccgctttttccag |
100 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29644194 |
cttcaattaactt-gttgattctttcagactttgtcatcatgggcgacttcaagcgtcgaagaagttgcttcaactggacctggaatccgctttttccag |
29644292 |
T |
|
| Q |
101 |
ttatatgtgagcaacaaaaacatcattctctcagttccatttcttc |
146 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
29644293 |
ttatatgtgagcgataaaaacatcattctctcagttccatttcttc |
29644338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 197
Target Start/End: Original strand, 29644341 - 29644373
Alignment:
| Q |
165 |
gcaatagtatttttctcttgtatgatgatatgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29644341 |
gcaatagtatttttctcttgtatgatgatatgt |
29644373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University