View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2617_high_5 (Length: 267)
Name: NF2617_high_5
Description: NF2617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2617_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 4197644 - 4197402
Alignment:
| Q |
10 |
ataattctacatgagatattggaaagtccttctacaatacaattgcttttggtatatatggatcacgaatgacgaccgcagttaatggaagcgcaactga |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
4197644 |
ataatcctacatgagatattggaaagtccttccacaatacaattgcttttggtatatatggatcacgaatgacggccggagttgatggaagcgcaactga |
4197545 |
T |
 |
| Q |
110 |
gagcgaagcggagctccttgatagggagtattgcattgtacacctacaagcattcggatgctcaagttagtctttgattgaggtgagtgagagatttaat |
209 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4197544 |
gtgcgaagcggagctccttgatagggagtattgcattgtacacctgcaagcattcggatgctcaagttagtctttgattgaggtgagtgagagatttaat |
4197445 |
T |
 |
| Q |
210 |
gaaaaacaatgtatatctttatctttgtataaaggtcatattt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4197444 |
gaaaaacaatgtatatctttatctttgtataaaggtcatattt |
4197402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University