View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2620_high_18 (Length: 238)
Name: NF2620_high_18
Description: NF2620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2620_high_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 49 - 238
Target Start/End: Original strand, 6003655 - 6003844
Alignment:
| Q |
49 |
gaaatggaatgcttttgctactttataaatggtgcattcacattcatgcaatcaggatatcgatggtcatttgatcaagatatgacagtctagatttaaa |
148 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| | | ||| |||||||||||||||||| |||||||||||| |
|
|
| T |
6003655 |
gaaatggaatccttttgctactttataaatgatgcattcacattcatgcaatcaggattacagtagtcgtttgatcaagatatgacaatctagatttaaa |
6003754 |
T |
|
| Q |
149 |
gtttgatattttagagttttaaaaatttaaatcgtcttgtctcgatctaacaaccacaaatgtgctgattacatgaatttccgagtatat |
238 |
Q |
| |
|
||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6003755 |
atttaatattttagagttttaaaaatctaaatcgtcttgtctcgatctaacgaccacaaatgtgctgattacatgaatttccgagtatat |
6003844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 129
Target Start/End: Complemental strand, 3351647 - 3351615
Alignment:
| Q |
97 |
caatcaggatatcgatggtcatttgatcaagat |
129 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
3351647 |
caatcaggatatcgatggtcattcgatcaagat |
3351615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University