View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2620_high_8 (Length: 309)
Name: NF2620_high_8
Description: NF2620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2620_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 67 - 292
Target Start/End: Original strand, 2625128 - 2625351
Alignment:
| Q |
67 |
gcatgtccttcatgagcaggtcggagactccattttaacnnnnnnnnnngtgggaatatcggacagagactcttacaaactgactcgcccagttggatag |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
2625128 |
gcatgtccttcatgagcaggtcggagactccattttagcaaaaaaaa--gtgggaatatcggacagagactcttacaaaccgactcacccagttggatag |
2625225 |
T |
|
| Q |
167 |
aggggaccgaatctgccttttccgggaacttcttgcattgcgcgaagaatatccacaaaaccaacctcttgatttccgagattttttatcgtctatcgtt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| |||||| |||||||||| |
|
|
| T |
2625226 |
aggggaccgaatctgccttttccgggaacttcttgcattgcgcgaagaatatccacaaaactgaccccctgatttccgagatgttttattgtctatcgtt |
2625325 |
T |
|
| Q |
267 |
tattttccaaataaatataatggatc |
292 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2625326 |
tattttccaaataaatataatggatc |
2625351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 2624975 - 2625038
Alignment:
| Q |
1 |
gtgaaaatcacgattaggagcataagaggtggacatttgccaaaccatgtatgagcactaccat |
64 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2624975 |
gtgaaaatcacggttaggagcgtaagaggtgcacatttgccaaaccatgtatgagcactaccat |
2625038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University