View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2620_low_21 (Length: 234)
Name: NF2620_low_21
Description: NF2620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2620_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 11 - 192
Target Start/End: Complemental strand, 41777209 - 41777028
Alignment:
| Q |
11 |
agtagcatagggaatggggaacctcttgagcaggtagaattcaaccacagacaatgatgatgaaaacatcatcacaaatgtcgctgttgcactagcaacc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41777209 |
agtaccatagggaatggggaacctcttgagtaggtagaattcaaccacagacaatgatgatgaaaacatcatcacaaatgtcgctgttgcactagcaacc |
41777110 |
T |
|
| Q |
111 |
tgcaatcaaaatccttgtaagttaaattgcttaagtttttagcttaaaatcaaactgtgtcatgcatgtgaagggatttggg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41777109 |
tgcaatcaaaatccttgtaagttaaattgcttaagtttttagcttaaaatcaaactgtgtcatgcatgtgaagggatttggg |
41777028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 27 - 116
Target Start/End: Original strand, 26956953 - 26957042
Alignment:
| Q |
27 |
gggaacctcttgagcaggtagaattcaaccacagacaatgatgatgaaaacatcatcacaaatgtcgctgttgcactagcaacctgcaat |
116 |
Q |
| |
|
|||||||||||||| | |||||| |||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26956953 |
gggaacctcttgagaatgtagaactcaaaaacagacaaagatgatgaaaacatcatcacaaatgttgctgttgcactagcaacctacaat |
26957042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University